From 8d17f862d354da941d01a42197e337d014185713 Mon Sep 17 00:00:00 2001
From: Hugo Madge Leon <hugo.madgeleon@stud.unibas.ch>
Date: Sun, 13 Nov 2022 12:48:42 +0000
Subject: [PATCH] Refactored + full functionality
---
frag_package/fragmentation_v2.py | 68 ++++++++++++--------------------
frag_package/main.py | 31 +++++++++++++++
frag_package/utils.py | 24 +++++++++++
3 files changed, 80 insertions(+), 43 deletions(-)
create mode 100644 frag_package/main.py
create mode 100644 frag_package/utils.py
diff --git a/frag_package/fragmentation_v2.py b/frag_package/fragmentation_v2.py
index eec7aff..bce9ca9 100644
--- a/frag_package/fragmentation_v2.py
+++ b/frag_package/fragmentation_v2.py
@@ -1,15 +1,36 @@
-import argparse
-import os.path
import re
import numpy as np
+import pandas as pd
-def fragmentation(fasta, seq_counts, mean_length, std):
+def fasta_process(fasta_file):
+ with open(fasta_file, "r") as f:
+ lines = f.readlines()
+
+ ident_pattern = re.compile('>(\S+)')
+ seq_pattern = re.compile('^(\S+)$')
+
+ genes = {}
+ for line in lines:
+ if ident_pattern.search(line):
+ seq_id = (ident_pattern.search(line)).group(1)
+ elif seq_id in genes.keys():
+ genes[seq_id] += (seq_pattern.search(line)).group(1)
+ else:
+ genes[seq_id] = (seq_pattern.search(line)).group(1)
+ return genes
+
+def fragmentation(fasta_file, counts_file, mean_length, std):
+ fasta = fasta_process(fasta_file)
+ seq_counts = pd.read_csv(counts_file, names = ["seqID", "count"])
+
nucs = ['A','T','G','C']
mononuc_freqs = [0.22, 0.25, 0.23, 0.30]
+
term_frags = []
- for seq, counts in dna_seq.items():
+ for seq_id, seq in fasta.items():
+ counts = seq_counts[seq_counts["seqID"] == seq_id]["count"]
for _ in range(counts):
n_cuts = int(len(seq)/mean_length)
@@ -40,42 +61,3 @@ def fragmentation(fasta, seq_counts, mean_length, std):
term_frags.append(term_frag)
return term_frags
-def main(args):
- fasta, seq_counts, mean_length, std = args
- dna_seq = {
- "ATAACATGTGGATGGCCAGTGGTCGGTTGTTACACGCCTACCGCGATGCTGAATGACCCGGACTAGAGTGGCGAAATTTATGGCGTGTGACCCGTTATGC": 100,
- "TCCATTTCGGTCAGTGGGTCATTGCTAGTAGTCGATTGCATTGCCATTCTCCGAGTGATTTAGCGTGACAGCCGCAGGGAACCCATAAAATGCAATCGTA": 100}
-
- term_frags = fragmentation(fasta, seq_counts, mean_length, std)
- with open('terminal_frags.txt', 'w') as f:
- for line in term_frags:
- f.write(line)
- f.write('\n')
-
-# found on https://stackoverflow.com/questions/11540854/file-as-command-line-argument-for-argparse-error-message-if-argument-is-not-va
-def extant_file(x):
- """
- 'Type' for argparse - checks that file exists but does not open.
- """
- if not os.path.exists(x):
- # Argparse uses the ArgumentTypeError to give a rejection message like:
- # error: argument input: x does not exist
- raise argparse.ArgumentTypeError("{0} does not exist".format(x))
- return x
-
-# Parse command-line arguments
-def parse_arguments():
- parser = argparse.ArgumentParser(description="Takes as input FASTA file of cDNA sequences, a CSV with sequence counts, and mean and std. dev. of fragment lengths. Outputs most terminal fragment (within desired length range) for each sequence.")
-
- parser.add_argument('--fasta', required=True, type=extant_file, help="FASTA file with cDNA sequences")
- parser.add_argument('--counts', required=True, type=extant_file, help="CSV file with sequence counts")
- parser.add_argument('--mean', required = False, default = 10, type = int, help="Mean fragment length (default: 10)")
- parser.add_argument('--std', required = False, default = 1, type = int, help="Standard deviation fragment length (defafult: 1)")
- args = parser.parse_args()
-
- return args.fasta, args.counts, args.mean, args.std
-
-
-if __name__ == '__main__':
- arguments = parse_arguments()
- main(arguments)
diff --git a/frag_package/main.py b/frag_package/main.py
new file mode 100644
index 0000000..661c8f3
--- /dev/null
+++ b/frag_package/main.py
@@ -0,0 +1,31 @@
+import argparse
+
+from fragmentation_v2 import fragmentation
+from utils import check_positive, extant_file
+
+
+def main(args):
+ fasta, seq_counts, mean_length, std = args
+
+ term_frags = fragmentation(fasta, seq_counts, mean_length, std)
+ with open('terminal_frags.txt', 'w') as f:
+ for line in term_frags:
+ f.write(line)
+ f.write('\n')
+
+# Parse command-line arguments
+def parse_arguments():
+ parser = argparse.ArgumentParser(description="Takes as input FASTA file of cDNA sequences, a CSV with sequence counts, and mean and std. dev. of fragment lengths. Outputs most terminal fragment (within desired length range) for each sequence.")
+
+ parser.add_argument('--fasta', required=True, type=extant_file, help="FASTA file with cDNA sequences")
+ parser.add_argument('--counts', required=True, type=extant_file, help="CSV file with sequence counts")
+ parser.add_argument('--mean', required = False, default = 10, type = check_positive, help="Mean fragment length (default: 10)")
+ parser.add_argument('--std', required = False, default = 1, type = check_positive, help="Standard deviation fragment length (defafult: 1)")
+ args = parser.parse_args()
+
+ return args.fasta, args.counts, args.mean, args.std
+
+
+if __name__ == '__main__':
+ arguments = parse_arguments()
+ main(arguments)
\ No newline at end of file
diff --git a/frag_package/utils.py b/frag_package/utils.py
new file mode 100644
index 0000000..2212bbc
--- /dev/null
+++ b/frag_package/utils.py
@@ -0,0 +1,24 @@
+import argparse
+import os.path
+
+
+# found on https://stackoverflow.com/questions/11540854/file-as-command-line-argument-for-argparse-error-message-if-argument-is-not-va
+def extant_file(x):
+ """
+ 'Type' for argparse - checks that file exists but does not open.
+ """
+ if not os.path.exists(x):
+ # Argparse uses the ArgumentTypeError to give a rejection message like:
+ # error: argument input: x does not exist
+ raise argparse.ArgumentTypeError("{0} does not exist".format(x))
+ elif not x.endswith((".fasta", ".fa", ".csv")):
+ raise argparse.ArgumentTypeError("{0} is not the correct file format".format(x))
+ return x
+
+# found on https://stackoverflow.com/questions/14117415/in-python-using-argparse-allow-only-positive-integers
+def check_positive(value):
+ ivalue = int(value)
+ if ivalue <= 0:
+ raise argparse.ArgumentTypeError("%s is an invalid positive int value" % value)
+ return ivalue
+
--
GitLab