Skip to content
Snippets Groups Projects
Commit e429a52f authored by Tanya Nandan's avatar Tanya Nandan
Browse files

frag script 2

parent 704eb0df
No related branches found
No related tags found
2 merge requests!54Tanya,!13Tanya
This commit is part of merge request !13. Comments created here will be created in the context of that merge request.
import pandas as pdimport randomimport numpy as npimport re dna_seq = { "ATAACATGTGGATGGCCAGTGGTCGGTTGTTACACGCCTACCGCGATGCTGAATGACCCGGACTAGAGTGGCGAAATTTATGGCGTGTGACCCGTTATGC": 100, "TCCATTTCGGTCAGTGGGTCATTGCTAGTAGTCGATTGCATTGCCATTCTCCGAGTGATTTAGCGTGACAGCCGCAGGGAACCCATAAAATGCAATCGTA": 100}nucs = ['A','T','G','C']mononuc_freqs = [0.22, 0.25, 0.23, 0.30] # A_dinuc_freqs = {'AA':0.27,'AT':0.25, 'AG':0.22, 'AC':0.26} # T_dinuc_freqs = {'TA':0.27, 'TT':0.24, 'TG':0.24, 'TC':0.25} # C_dinuc_freqs = {'CA':0.23, 'CT':0.21, 'CG':0.35, 'CC':0.21} # G_dinuc_freqs = {'GA':0.25, 'GT':0.25, 'GG':0.23, 'GC':0.27} mean_length = 12 std = 1 term_frags = [] for seq, counts in dna_seq.items(): for _ in range(counts): n_cuts = int(len(seq)/mean_length) # non-random DNA fragmentation implementation based on https://www.nature.com/articles/srep04532#Sec1 # assume fragmentation by sonication for NGS workflow cuts = [] cut_nucs = np.random.choice(nucs, n_cuts, p=mononuc_freqs) for nuc in cut_nucs: nuc_pos = [x.start() for x in re.finditer(nuc, seq)] pos = np.random.choice(nuc_pos) while pos in cuts: pos = np.random.choice(nuc_pos) cuts.append(pos) cuts.sort() cuts.insert(0,0) term_frag = "" for i, val in enumerate(cuts): if i == len(cuts)-1: fragment = seq[val+1:cuts[-1]] else: fragment = seq[val:cuts[i+1]] if mean_length-std <= len(fragment) <= mean_length+std: term_frag = fragment if term_frag == "": continue else: term_frags.append(term_frag) with open('terminal_frags.txt', 'w') as f: for line in term_frags: f.write(line) f.write('\n')
\ No newline at end of file
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment