DO NOT MERGE: remove all content for review

README.md

-# cDNA Generator
-
-Description of the project
-
-
-
-**Input files**
-
-Copy_number_file:
-
-- csv-formatted file ("NewTranscriptID,ID,Count")
-
-- id of generated transcript
-
-- id of original transcript (without intron inclusions)
-count
-
-_Eample_
-
-`[id of generated transcript]    [ID]    [Count]`
-
-
-transcript_sequences_file:
-
-- fasta-formatted file 
-
-- id of generated transcript? (in the header)
-
-_Eample_
-
-`> [id of generated transcript]
-AGUGACGUUAGACCAGAUAGAC....`
-
-
-priming_site_file:
-
-- gtf-formatted file 
-
-- id of generated transcript?
-
-- position of priming site and binding likelihood 
-
-_Eample_
-
-`[id of generated transcript]    ... [position of priming site]... [binding likelihood ]`
-
-
-**Output files**
-
-cDNA_file:
-
-- fasta-formatted file 
-
-- Includes all the uniquie "cDNA sequence" and "cDNA sequence ID"
-
-
-
-cDNA_count_file:
-
-- csv-formatted file 
-
-- Includes "cDNA sequence ID" and "cDNA count"
-
-
-
-
-
-

Test/copy_number_file.csv

-NewTranscriptID, ID, Count
-1,1,12
-2,1,11
-3,2,33
-4,3,11
-5,4,55

Test/priming_sites.gtf

-Transcript_1	RIBlast	Priming_site	10	25	.	+	.	Accessibility_Energy "1.49"; Hybridization_Energy "-9.76"; Interaction_Energy "-8.74"; Number_of_binding_sites "2"; Binding_Probability "0.12"
-Transcript_1	RIBlast	Priming_site	640	655	.	+	.	Accessibility_Energy "1.71"; Hybridization_Energy "-9.12"; Interaction_Energy "-8.34"; Number_of_binding_sites "2"; Binding_Probability "0.05"
-Transcript_2	RIBlast	Priming_site	3	18	.	+	.	Accessibility_Energy "1.21"; Hybridization_Energy "-5.12"; Interaction_Energy "-2.34"; Number_of_binding_sites "1"; Binding_Probability "0.15"

Test/transcript.fasta

->1
-GAUAGCUAGAGGAUUCUCAGAGGAGAAGCUAGAGGAGCUAGAGGAGCUAGAGGAGCUAGAGGAGCUAGAGG
->2
-AGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAGCUAGAGGAGCUAGAGGAGCUAGAGG
->3
-AGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAGCUAGAGG
->4
-AGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAGCUAGAGGAGCUAGAGG

cdna/cdna.py

-import sys
-
-def translate(res):
-    translate_dict = {"A": "T", "U": "A", "G": "C", "C":"G"}
-    if res not in translate_dict.keys():
-        print("cDNA residue not A,T,U or G ")
-        sys.exit(1)
-    return translate_dict[res]
-
-class cDNA_Gen:
-    def __init__(self, 
-                 fasta, 
-                 gtf, 
-                 cpn, 
-                 output_fasta = "cDNA.fasta",
-                 output_csv = "cDNA.csv"
-                ):
-        # inputs
-        self.fasta = fasta
-        self.gtf = gtf
-        self.cpn = cpn
-        self.output_fasta = output_fasta
-        self.output_csv = output_csv
-        # variables
-        self.prime_sites = []
-        self.fasta_seq = ""
-        self.fasta_id = ""
-        self.copy_numbers = {}
-        
-        self.run()
-        
-    def run(self):
-        self.read_fasta()
-        self.read_gtf()
-        
-    def order_priming_sites(self):
-        pass
-    
-    def generate_cdna(self):
-        pass
-    
-    
-    def read_fasta(self):
-        fasta = open(self.fasta).readlines()
-        self.fasta_id = fasta[0]
-        print(fasta[0])
-        self.fasta_seq = "".join([_.rstrip() for _ in fasta[1:]])
-        
-    
-    def read_gtf(self):
-        with open(self.gtf) as gtf_file:
-            gtf_lines = gtf_file.readlines()
-            for line in gtf_lines[:1000]:
-                if not line.startswith("#"):
-                    temp_gtf = GTF_entry(line)
-                    temp_gtf.set_sequence(self.fasta_seq)
-                    self.prime_sites.append(temp_gtf)
-
-    def write_fasta(self):
-        pass
-    
-    def read_copy_numbers(self):
-        with open(self.cpn) as cpn_file:
-            cpn_lines = cpn_file.readlines()
-            for line in cpn_lines:
-                csv = line.split(",")
-                trans_id = csv[0]
-                if trans_id:
-                    gene_id = csv[1]
-                    count = csv[2]
-                    self.copy_numbers[gene_id] = count
-                
-    
-    def return_output(self):
-        return self.output_fasta, self.output_csv
-    
-
-class GTF_entry:
-    def __init__(self, string):
-        self.string = string
-        self.values = self.string.split("\t")
-        self.id = self.values[0]
-        self.start = int(self.values[3])
-        self.end = int(self.values[4])
-        self.score = float(0.5) #self.values[5]
-        self.sequence = "no sequence set"
-        self.length = self.end - self.start
-        
-    def __repr__(self):
-        return self.sequence[:10] + "..." + f" len={self.length} score={self.score}"
-    
-    def set_sequence(self, full_sequence):
-        self.sequence = full_sequence[self.start:self.end]
-    
-    
-if __name__ == "__main__":
-    import argparse
-    pass
-    
-