Skip to content
Snippets Groups Projects
Commit fc7fba87 authored by Eric Boittier's avatar Eric Boittier
Browse files

changed directory name

parent efb4fca3
No related branches found
No related tags found
No related merge requests found
No preview for this file type
€ python:S101 "bRename class "cDNA_Gen" to match the regular expression ^_?([A-Z_][a-zA-Z0-9]*|[a-z_][a-z0-9_]*)$.(ŒŒúö8Ųþ¿Ã0
} python:S1186&"YAdd a nested comment explaining why this method is empty, or complete the implementation.(—™£ªüÿÿÿÿ8Ȳþ¿Ã0
x python:S1186)"YAdd a nested comment explaining why this method is empty, or complete the implementation.(—À†Ž8ɲþ¿Ã0
} python:S1186;"YAdd a nested comment explaining why this method is empty, or complete the implementation.(· ¿Êüÿÿÿÿ8ʲþ¿Ã0
† python:S101M"cRename class "GTF_entry" to match the regular expression ^_?([A-Z_][a-zA-Z0-9]*|[a-z_][a-z0-9_]*)$.(Ö‰‚Ãÿÿÿÿÿ8ʲþ¿Ã0
; python:S2772a"Remove this unneeded "pass".(ã‘Û¾8ʲþ¿Ã0
\ No newline at end of file
<?xml version="1.0" encoding="UTF-8"?>
<project version="4">
<component name="ChangeListManager">
<list default="true" id="4a8c5eec-e14f-46f8-83f6-218471f8c20b" name="Changes" comment="" />
<option name="SHOW_DIALOG" value="false" />
<option name="HIGHLIGHT_CONFLICTS" value="true" />
<option name="HIGHLIGHT_NON_ACTIVE_CHANGELIST" value="false" />
<option name="LAST_RESOLUTION" value="IGNORE" />
</component>
<component name="Git.Settings">
<option name="RECENT_GIT_ROOT_PATH" value="$PROJECT_DIR$" />
</component>
<component name="MarkdownSettingsMigration">
<option name="stateVersion" value="1" />
</component>
<component name="ProjectId" id="2GzM5DMpjLKSe0zWWtlaBWfsqTD" />
<component name="ProjectLevelVcsManager" settingsEditedManually="true" />
<component name="ProjectViewState">
<option name="hideEmptyMiddlePackages" value="true" />
<option name="showLibraryContents" value="true" />
</component>
<component name="PropertiesComponent"><![CDATA[{
"keyToString": {
"RunOnceActivity.OpenProjectViewOnStart": "true",
"RunOnceActivity.ShowReadmeOnStart": "true",
"WebServerToolWindowFactoryState": "false",
"last_opened_file_path": "/Users/ericboittier/Documents/github/cdna-generator"
}
}]]></component>
<component name="SpellCheckerSettings" RuntimeDictionaries="0" Folders="0" CustomDictionaries="0" DefaultDictionary="application-level" UseSingleDictionary="true" transferred="true" />
<component name="TaskManager">
<task active="true" id="Default" summary="Default task">
<changelist id="4a8c5eec-e14f-46f8-83f6-218471f8c20b" name="Changes" comment="" />
<created>1667386773933</created>
<option name="number" value="Default" />
<option name="presentableId" value="Default" />
<updated>1667386773933</updated>
<workItem from="1667386779377" duration="1232000" />
</task>
<servers />
</component>
<component name="TypeScriptGeneratedFilesManager">
<option name="version" value="3" />
</component>
</project>
\ No newline at end of file
This diff is collapsed.
cdna.ipynb 0 → 100644
This diff is collapsed.
NewTranscriptID,ID,Count
ID1,ID,4
\ No newline at end of file
File moved
File moved
>1
GAUAGCUAGAGGAUUCUCAGAGGAGAAGCUAGAGGAGCUAGAGGAGCUAGAGGAGCUAGAGGAGCUAGAGG
>2
AGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAGCUAGAGGAGCUAGAGGAGCUAGAGG
>3
AGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAGCUAGAGG
>4
AGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAUAGCUAGAGGAGCUAGAGGAGCUAGAGG
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment