Skip to content
Snippets Groups Projects
Commit a3ab4a7e authored by Alex Kanitz's avatar Alex Kanitz
Browse files

docs: add README.md

parent 98bfad62
No related branches found
No related tags found
1 merge request!1docs: add README.md
README.md 0 → 100644
# ASCII-style alignment pileup
## Description
Generates an ASCII-style pileup of read alignments in one or more BAM files
against one or more regions specified in a BED file.
## Usage
```sh
ascii_alignment_pileup.R [-hv] [OPTIONS] bed bam [bam2 ...]
```
## Requirements
* R 3.6.0
* GenomicAlignments 1.20.0
* optparse 1.6.2
* rtracklayer 1.44.0
* tools 3.6.0
## Input files
* [BED](https://www.ensembl.org/info/website/upload/bed.html) file
* [BAM](https://samtools.github.io/hts-specs/) file(s)
* Optional: [FASTA](https://en.wikipedia.org/wiki/FASTA_format) file compressed
with [`bgzip`](http://www.htslib.org/doc/bgzip.html)
* Optional:
[GFF/GTF/GFF3](https://en.wikipedia.org/wiki/General_feature_format) file
## Output files
* Custom file format:
```console
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> hsa-let-7a-1
.....>>>>>>>>>>>>>>>>>>>>>>..................................................... hsa-let-7a-5p
........................................................>>>>>>>>>>>>>>>>>>>>>... hsa-let-7a-3p
TGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTA 9:94175957-94176036:+
TACCATGAGGTAGTAGGTTGTATAGTT..................................................... 1
...CATGAGGTAGTAGGTTGTATAGTT..................................................... 10
...GA-GAGGTAGTAGGTTGTATAGTT..................................................... 2
....A-GAGGTAGTAGGTTGTATAGTT..................................................... 19
.....TGAGGTAGTAGGTTGTATAGTT..................................................... 17
......GAGGTAGTAGGTTGTATAGTT..................................................... 33
.......AGGTAGTAGGTTGTATAGTT..................................................... 9
.......AGGTAGTAGGTTGTATAGTTT.................................................... 2
........GGTAGTAGGTTGTATAGTT..................................................... 7
...................................................GATAACTATACAATCTACTGTCTT..... 1
......................................................AACTATACAATCTACT.......... 1
........................................................CTATACAATCTACTGTCTTTCT.. 28
........................................................CTATACAATCTACTGTCTTTC-T. 22
........................................................CTATACAATCTACTGTCTTTCC.. 19
........................................................CTATACAATCTACTGTCTTTC... 12
........................................................CTATACAATCTACTGTCTTTCTT. 2
........................................................CTATACAATCTACTGTC....... 1
........................................................CTATACAATCTACTGTCTT..... 1
........................................................CTATACAATCTACTGTCTTTCG.. 1
.........................................................TATACAATCTACTGTCTTTCT.. 4
.........................................................TATACAATCTACTGTCTTTC-T. 4
.........................................................TATACAATCTACTGTCTTTC... 2
.........................................................TATACAATCTACTGTCTTTCC.. 1
.........................................................TATACAATCTACTGTCTTTCCT. 1
```
## Options
```console
--reference=FILE
Reference genome sequence in FASTA format. The file *MUST* be compressed
with BGZIP. If supplied, the reference sequence for the query region(s) will
be added to the output. Note that on the first run with a specific reference
genome file, an FAI index is generated which will take some time.
--annotations=FILE
Annotation file in GFF/GTF format used to annotate sequences. If
supplied, features overlapping the query region(s) will be visualized in the
output. Ensure that the argument to option `annotation-name-field`
corresponds to a field in the annotations, otherwise the script will fail.
--output-directory=DIR
Output directory. One output file will be created for each region in
`--bed` and the filenames will be generated from the basenames of the
supplied BAM file(s) and the name field (4th column) of the BED file.
[default "."]
--maximum-region-width=INT
Maximum input region width. Use with care as wide regions will use
excessive resources. [default 200]
--do-not-collapse-alignments
Show alignments of reads with identical sequences individually.
--minimum-count=INT
Alignments of reads with less copies than the specified number will not
be printed. Option is not considered if `do-not-collapse-alignments` is
set. [default 1]
--annotation-name-field=STR
Annotation field used to populate the `name` column in the output.
[default "Name"]
--padding-character=CHAR
Character used for padding alignments. [default "."]
--indel-character=CHAR
Character to denote insertions and deletions in alignments.
[default "-"]
-h, --help
Show this information and die.
-v, --verbose
Print log messages to STDOUT.
```
## Contact
Email: <zavolab-biozentrum@unibas.ch>
&copy; 2019 Zavolab, Biozentrum, University of Basel
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment