Skip to content
Snippets Groups Projects
Commit a5c6a4a0 authored by Alex Kanitz's avatar Alex Kanitz
Browse files

fix: ref does not match pileups in example

parent b95bc0e9
No related branches found
No related tags found
1 merge request!9fix: ref does not match pileups in example
Pipeline #15143 passed
...@@ -55,7 +55,7 @@ of BAM and FASTA files (`test.sam` and `test.fa`, respectively) are provided. ...@@ -55,7 +55,7 @@ of BAM and FASTA files (`test.sam` and `test.fa`, respectively) are provided.
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> test-mir >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> test-mir
....>>>>>>>>>>>>>>>>>>>>>>..................................................... test-mir-5p ....>>>>>>>>>>>>>>>>>>>>>>..................................................... test-mir-5p
.......................................................>>>>>>>>>>>>>>>>>>>>>... test-mir-3p .......................................................>>>>>>>>>>>>>>>>>>>>>... test-mir-3p
ATCTCAGCACTTTGAGAGGCCAAAGTGGATGGATCACTTGAGGCCAGGAGTTCAAGACCAGCCTGGCCAACAAGGTGAA test_ref:3618-3696:+ GGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTA test_ref:3618-3696:+
ACCATGAGGTAGTAGGTTGTATAGTT..................................................... 1 ACCATGAGGTAGTAGGTTGTATAGTT..................................................... 1
..CATGAGGTAGTAGGTTGTATAGTT..................................................... 10 ..CATGAGGTAGTAGGTTGTATAGTT..................................................... 10
..GA-GAGGTAGTAGGTTGTATAGTT..................................................... 2 ..GA-GAGGTAGTAGGTTGTATAGTT..................................................... 2
...@@ -111,7 +111,7 @@ Then run the test command above. ...@@ -111,7 +111,7 @@ Then run the test command above.
In both cases, a successful test run with the above command will create a file In both cases, a successful test run with the above command will create a file
`test.test-mir.min.1.pileup.tab` in the current working directory with MD5 sum `test.test-mir.min.1.pileup.tab` in the current working directory with MD5 sum
`6b5a66981bd83329219002897be393a6`. `c9fe3f47da7d73b864823e1fc0636d4c`.
## Options ## Options
...@@ -168,7 +168,8 @@ In both cases, a successful test run with the above command will create a file ...@@ -168,7 +168,8 @@ In both cases, a successful test run with the above command will create a file
To create a BGZIP-compressed copy of your reference file in FASTA format, as To create a BGZIP-compressed copy of your reference file in FASTA format, as
required by option `--reference`, you will need the `bgzip` utility that comes required by option `--reference`, you will need the `bgzip` utility that comes
with the [HTSlib][htslib] suite. with the [HTSlib][htslib] suite. If you have have installed dependencies via
Conda, then the HTSlib suite will be already installed.
Supposing you have HTSlib installed and have a reference file `test.fa` in Supposing you have HTSlib installed and have a reference file `test.fa` in
your current working directory, you can create a BGZIP-compressed copy of it your current working directory, you can create a BGZIP-compressed copy of it
......
...@@ -29,7 +29,7 @@ against one or more regions specified in a BED file.\n" ...@@ -29,7 +29,7 @@ against one or more regions specified in a BED file.\n"
author <- "Author: Alexander Kanitz" author <- "Author: Alexander Kanitz"
affiliation <- "Affiliation: Biozentrum, University of Basel" affiliation <- "Affiliation: Biozentrum, University of Basel"
email <- "Email: alexander.kanitz@alumni.ethz.ch" email <- "Email: alexander.kanitz@alumni.ethz.ch"
version <- "1.1.0" version <- "1.1.1"
version_formatted <- paste("Version:", version, sep=" ") version_formatted <- paste("Version:", version, sep=" ")
requirements <- c("optparse", "rtracklayer", "GenomicAlignments", "tools") requirements <- c("optparse", "rtracklayer", "GenomicAlignments", "tools")
requirements_txt <- paste("Requires:", paste(requirements, collapse=", "), sep=" ") requirements_txt <- paste("Requires:", paste(requirements, collapse=", "), sep=" ")
......
...@@ -5,3 +5,4 @@ channels: ...@@ -5,3 +5,4 @@ channels:
dependencies: dependencies:
- r-optparse=1.7.1 - r-optparse=1.7.1
- bioconductor-rtracklayer=1.54.0 - bioconductor-rtracklayer=1.54.0
- tabix=1.11
6b5a66981bd83329219002897be393a6 test.test-mir.min.1.pileup.tab c9fe3f47da7d73b864823e1fc0636d4c test.test-mir.min.1.pileup.tab
This diff is collapsed.
No preview for this file type
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> test-mir >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> test-mir
....>>>>>>>>>>>>>>>>>>>>>>..................................................... test-mir-5p ....>>>>>>>>>>>>>>>>>>>>>>..................................................... test-mir-5p
.......................................................>>>>>>>>>>>>>>>>>>>>>... test-mir-3p .......................................................>>>>>>>>>>>>>>>>>>>>>... test-mir-3p
ATCTCAGCACTTTGAGAGGCCAAAGTGGATGGATCACTTGAGGCCAGGAGTTCAAGACCAGCCTGGCCAACAAGGTGAA test_ref:3618-3696:+ GGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTA test_ref:3618-3696:+
ACCATGAGGTAGTAGGTTGTATAGTT..................................................... 1 ACCATGAGGTAGTAGGTTGTATAGTT..................................................... 1
..CATGAGGTAGTAGGTTGTATAGTT..................................................... 10 ..CATGAGGTAGTAGGTTGTATAGTT..................................................... 10
..GA-GAGGTAGTAGGTTGTATAGTT..................................................... 2 ..GA-GAGGTAGTAGGTTGTATAGTT..................................................... 2
......
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment