Skip to content
Snippets Groups Projects
Commit 8d17f862 authored by Hugo Madge Leon's avatar Hugo Madge Leon
Browse files

Refactored + full functionality

parent 002845e6
Branches
No related tags found
1 merge request!18Refactored + full functionality
import argparse
import os.path
import re import re
import numpy as np import numpy as np
import pandas as pd
def fragmentation(fasta, seq_counts, mean_length, std): def fasta_process(fasta_file):
with open(fasta_file, "r") as f:
lines = f.readlines()
ident_pattern = re.compile('>(\S+)')
seq_pattern = re.compile('^(\S+)$')
genes = {}
for line in lines:
if ident_pattern.search(line):
seq_id = (ident_pattern.search(line)).group(1)
elif seq_id in genes.keys():
genes[seq_id] += (seq_pattern.search(line)).group(1)
else:
genes[seq_id] = (seq_pattern.search(line)).group(1)
return genes
def fragmentation(fasta_file, counts_file, mean_length, std):
fasta = fasta_process(fasta_file)
seq_counts = pd.read_csv(counts_file, names = ["seqID", "count"])
nucs = ['A','T','G','C'] nucs = ['A','T','G','C']
mononuc_freqs = [0.22, 0.25, 0.23, 0.30] mononuc_freqs = [0.22, 0.25, 0.23, 0.30]
term_frags = [] term_frags = []
for seq, counts in dna_seq.items(): for seq_id, seq in fasta.items():
counts = seq_counts[seq_counts["seqID"] == seq_id]["count"]
for _ in range(counts): for _ in range(counts):
n_cuts = int(len(seq)/mean_length) n_cuts = int(len(seq)/mean_length)
...@@ -40,42 +61,3 @@ def fragmentation(fasta, seq_counts, mean_length, std): ...@@ -40,42 +61,3 @@ def fragmentation(fasta, seq_counts, mean_length, std):
term_frags.append(term_frag) term_frags.append(term_frag)
return term_frags return term_frags
def main(args):
fasta, seq_counts, mean_length, std = args
dna_seq = {
"ATAACATGTGGATGGCCAGTGGTCGGTTGTTACACGCCTACCGCGATGCTGAATGACCCGGACTAGAGTGGCGAAATTTATGGCGTGTGACCCGTTATGC": 100,
"TCCATTTCGGTCAGTGGGTCATTGCTAGTAGTCGATTGCATTGCCATTCTCCGAGTGATTTAGCGTGACAGCCGCAGGGAACCCATAAAATGCAATCGTA": 100}
term_frags = fragmentation(fasta, seq_counts, mean_length, std)
with open('terminal_frags.txt', 'w') as f:
for line in term_frags:
f.write(line)
f.write('\n')
# found on https://stackoverflow.com/questions/11540854/file-as-command-line-argument-for-argparse-error-message-if-argument-is-not-va
def extant_file(x):
"""
'Type' for argparse - checks that file exists but does not open.
"""
if not os.path.exists(x):
# Argparse uses the ArgumentTypeError to give a rejection message like:
# error: argument input: x does not exist
raise argparse.ArgumentTypeError("{0} does not exist".format(x))
return x
# Parse command-line arguments
def parse_arguments():
parser = argparse.ArgumentParser(description="Takes as input FASTA file of cDNA sequences, a CSV with sequence counts, and mean and std. dev. of fragment lengths. Outputs most terminal fragment (within desired length range) for each sequence.")
parser.add_argument('--fasta', required=True, type=extant_file, help="FASTA file with cDNA sequences")
parser.add_argument('--counts', required=True, type=extant_file, help="CSV file with sequence counts")
parser.add_argument('--mean', required = False, default = 10, type = int, help="Mean fragment length (default: 10)")
parser.add_argument('--std', required = False, default = 1, type = int, help="Standard deviation fragment length (defafult: 1)")
args = parser.parse_args()
return args.fasta, args.counts, args.mean, args.std
if __name__ == '__main__':
arguments = parse_arguments()
main(arguments)
import argparse
from fragmentation_v2 import fragmentation
from utils import check_positive, extant_file
def main(args):
fasta, seq_counts, mean_length, std = args
term_frags = fragmentation(fasta, seq_counts, mean_length, std)
with open('terminal_frags.txt', 'w') as f:
for line in term_frags:
f.write(line)
f.write('\n')
# Parse command-line arguments
def parse_arguments():
parser = argparse.ArgumentParser(description="Takes as input FASTA file of cDNA sequences, a CSV with sequence counts, and mean and std. dev. of fragment lengths. Outputs most terminal fragment (within desired length range) for each sequence.")
parser.add_argument('--fasta', required=True, type=extant_file, help="FASTA file with cDNA sequences")
parser.add_argument('--counts', required=True, type=extant_file, help="CSV file with sequence counts")
parser.add_argument('--mean', required = False, default = 10, type = check_positive, help="Mean fragment length (default: 10)")
parser.add_argument('--std', required = False, default = 1, type = check_positive, help="Standard deviation fragment length (defafult: 1)")
args = parser.parse_args()
return args.fasta, args.counts, args.mean, args.std
if __name__ == '__main__':
arguments = parse_arguments()
main(arguments)
\ No newline at end of file
import argparse
import os.path
# found on https://stackoverflow.com/questions/11540854/file-as-command-line-argument-for-argparse-error-message-if-argument-is-not-va
def extant_file(x):
"""
'Type' for argparse - checks that file exists but does not open.
"""
if not os.path.exists(x):
# Argparse uses the ArgumentTypeError to give a rejection message like:
# error: argument input: x does not exist
raise argparse.ArgumentTypeError("{0} does not exist".format(x))
elif not x.endswith((".fasta", ".fa", ".csv")):
raise argparse.ArgumentTypeError("{0} is not the correct file format".format(x))
return x
# found on https://stackoverflow.com/questions/14117415/in-python-using-argparse-allow-only-positive-integers
def check_positive(value):
ivalue = int(value)
if ivalue <= 0:
raise argparse.ArgumentTypeError("%s is an invalid positive int value" % value)
return ivalue
0% Loading or .
You are about to add 0 people to the discussion. Proceed with caution.
Please register or to comment